Research

Oligonucleotides

Target promoter region or target genePrimerSequence
LEE1 LEE1-I (forward) 5' ATGAATTCATCTGATGCCAAGTA 3'
LEE1-II (reverse) 5' ATGGATCCCTATAAGCTGAATG 3'
LEE2 LEE2-I (forward) 5' ATGAATTCCAACAACAATATTACC 3'
LEE2-II (reverse) 5' ATGGATCCGACATTTACCTGG 3'
LEE3 LEE3-I (forward) 5' ATGAATTCGTTTGCGTTGAGCA 3'
LEE3-II (reverse) 5' ATGGATCCATTCATCTGCAGG 3'
LEE4 LEE4-I (forward) 5' ATGAATTCTGGTTATTGCAAATGA 3'
LEE4-II (reverse) 5' ATGGATCCAAATCTAATGAATTAG 3'
LEE5 or tir LEE5-I (forward) 5' ATGAATTCTACACGTTTTAACACT 3'
LEE5-II (reverse) 5' ATGGATCCATGCAGAGGGTC 3'
per per-I (forward) 5' ATGAATTCCGGTGCCATATTAC 3'
per-II (reverse) 5' ATGGATCCCTTGTTTCTTATCTT 3'
bfp bfp-I (forward) 5' ATGAATTCTTCTGCTCAAATCCT 3'
bfp-II (reverse) 5' ATGGATCCTGGTTGAATCAGTA 3'
fliA fliA-I (forward) 5' ATGAATTCATATCAGAAGAAGGCAGGCT 3'
fliA-II (reverse) 5' ATGGATCCAAACCCGCTACAACAACTAC 3'
fliC fliC-I (forward) 5' ATGAATTCCCGCTTAACGATGA 3'
fliC-II (reverse) 5' ATGGATCCACAGCGCAGACT 3'
flhDC flhD-I (forward) 5' ATGAATTCTCGTCAGGCGTTAA 3'
flhD-II (reverse) 5' ATGGATCCCCAGACGATTACT 3'
bla bla-I (forward) 5' ATGAATTCTCTTGAAGACGAAAGGGCCT 3'
bla-(reverse) 5' ATGGATCCATTGTTGCCGGGAAGCTAGA 3'
fimA gene fimA-I 5' GGAAAGCAGCATGAAAATTAAAACTCTGGCA ATCGTTGTTCTTGTAGGCTGGAGCTGCTTC 3'
fimA-II 5' TTGATACTGAACCTTGAAGGTCGCATCCGCAT TAGCAGCACCATATGAATATGCTCCTTA 3'
flu gene flu-I 5' ATGGCAACCGACACGGTTGTGAATACCGGCG CGGAAGGGGGTGTAGGCTGGAGCTGCTTC 3'
flu-I 5' CCCTGCTTCAGGGTGACATTCGTGGCTGTACC ACCGGCGTTCATATGAATATGCTCCTTA 3'